plasmid expressing rabies virus g protein (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
plasmid expressing rabies virus g protein
Plasmid Expressing Rabies Virus G Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+expressing+rabies+virus+g+protein/pAAV-EF1a-FLEX-GTB+(Plasmid+%2326197)/bio_rxiv__2025__01__20__633641-220-35-41
Average 93 stars, based on 20 article reviews
Plasmid Expressing Rabies Virus G Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plasmid+expressing+rabies+virus+g+protein/pAAV-EF1a-FLEX-GTB+(Plasmid+%2326197)/bio_rxiv__2025__01__20__633641-220-35-41
Average 93 stars, based on 20 article reviews
plasmid expressing rabies virus g protein - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Sequencing:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a Polymerase Chain Reaction:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a Virus:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a Amplification:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a Plasmid Preparation:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a Expressing:Article Title: A cholinergic spinal pathway for the adaptive control of breathing Article Snippet: .. Briefly, a T7 polymerase promoter sequence was added to the 5’ end of the reverse primer of the PCR primers for rabies virus G protein (Forward: AAAGCATTTCCGCCCAACAC, Reverse: TAATACGACTCACTATAGGGCCTCGTCACCGTCCTTGAAA) and DNA was amplified from a |